All pastes›Public feed

Public feed

Pastes people chose to make public. Author names hidden.
  • Anonymous

    2081025·text·1.6 KB·2011-09-19 05:11 UTC
    2011-09-19 03:53:54 [INFO] [PLAYER_COMMAND] TheSafo: /tp ang
    2011-09-19 03:58:14 [INFO] [PLAYER_COMMAND] TheSafo: /time day
    2011-09-19 03:59:00 [INFO] [PLAYER_COMMAND] TheSafo: /tp ang
    2011-09-19 0
  • artyom

    2080990·actionscript·73 B·2011-09-19 04:31 UTC
    how many time i do not do what i want to do but do what i dont want to do
  • Unnamed

    2080972·text·3.7 KB·2011-09-19 03:53 UTC
    Starting Nmap 5.51 ( http://nmap.org ) at 2011-09-18 23:43 AST
    NSE: Loaded 57 scripts for scanning.
    Initiating Ping Scan at 23:43
    Scanning tmweb.ru (92.53.116.19) [4 ports]
    Completed Ping Scan a
  • Teepan

    2080964·text·74 B·2011-09-19 03:42 UTC
    http://www.deathbylogic.com/2008/12/verilog-seven-segment-display-decoder/
  • Unnamed

    2080963·text·413 B·2011-09-19 03:39 UTC
    Intel i7-2600K 320
    AsRock ASRock Z68 Extreme4 179
    8G (4Gx2) 2133 Patriot Viper-Xtreme 2 97
    OCZ Solid 3 120GB 189
    WD Green 2TB
  • Unnamed

    2080962·text·262 B·2011-09-19 03:38 UTC
    Intel i7-2600K 320
    AsRock ASRock Z68 Extreme4 179
    8G (4Gx2) 2133 Patriot Viper-Xtreme Div.2 2 97
    OCZ Solid 3 120GB 189
    WD Green 2TB 83
    CoolerMaster HAF 922 125
    Antec HCG-
  • Anonymous

    2080961·text·388.0 KB·2011-09-19 03:38 UTC
    
        
  • Unnamed

    2080939·text·348 B·2011-09-19 02:06 UTC
    /cygdrive/e/libre/libreoffice-bootstrap-3.4.3.2/solver/340/wntmsci12.pro/workdir
    /Dep/LinkTarget/Library/isw.lib.d:111732: *** multiple target patterns. Stop.
    
    the offending line in isw.lib.d is
  • Unnamed

    2080935·text·874 B·2011-09-19 01:57 UTC
    $ORIGIN sydunco.com.au.
    $TTL 3600
    @ IN SOA ns1.softlayer.com. root.sydunco.com.au. (
     2011041204 ; Serial
     3600 ; Refresh
  • Anonymous

    2080934·text·420 B·2011-09-19 01:44 UTC
    Blitchiz TvT
    
    10 depot
    12 rax
    13 gas
    15 orbital
    16 marine
    16 depot
    18 factory
    20 second gas
    23 Starport
    24 Reactor on Barracks
    
    Tech lab on starport when it completes
    
    Make hellions fro
  • Unnamed

    2080931·text·2.8 KB·2011-09-19 01:09 UTC
    /*****************************************************
     *
     * TwoCube.c
     *
     * Jason Ng 100383886
     *
     * Question 1b - Assignment 1
     * Displays 2 cubes rotating in opposite di
  • Someone

    2080923·text·130 B·2011-09-19 00:54 UTC
    Please don't neglect "-" when grouping packages in Linkgrabber. It is very annoying and this only happens in your newest version.
  • Stuff

    2080915·text·680 B·2011-09-18 23:52 UTC
    if ( isset($start) ) {
     $params[':time_range_start'] = $start;
     $start_sql .= ' ((dtend IS NULL AND dtstart > :time_range_start) OR dtend > :time_range_start) ';
     }
  • Stuff

    2080912·text·682 B·2011-09-18 23:34 UTC
    if ( isset($start) ) {
     $params[':time_range_start'] = $start;
     $start_sql .= ' ((dtend IS NULL AND dtstart > :time_range_start) OR dtend > :time_range_start) ';
     }
  • Stuff

    2080911·text·681 B·2011-09-18 23:26 UTC
    if ( isset($start) ) {
     $params[':time_range_start'] = $start;
     $start_sql .= ' ((dtend IS NULL AND dtstart > :time_range_start) OR dtend > :time_range_start) ';
     }
  • Stuff

    2080910·text·684 B·2011-09-18 23:23 UTC
    if ( isset($start) ) {
     $params[':time_range_start'] = $start;
     $start_sql .= ' (dtend IS NULL AND dtstart > :time_range_start) OR dtend > :time_range_start) ';
     }
  • pi31415

    2080907·text·1.7 KB·2011-09-18 23:13 UTC
    # This version crashes.
    package require Tclsdl
    set screen [sdl::surface -width 640 -height 480 -bpp 32]
    vwait forever
    
    # This version does not crash.
    package require Tclsdl
    package require Tk
  • pi31415

    2080896·text·427 B·2011-09-18 22:42 UTC
    # This version crashes.
    package require Tclsdl
    set screen [sdl::surface -width 640 -height 480 -bpp 32]
    vwait forever
    
    # This version does not crash.
    package require Tclsdl
    package require Tk
  • Something

    2080895·text·10 B·2011-09-18 22:42 UTC
    :) the gam
  • Untitled

    2080891·text·1.3 KB·2011-09-18 22:07 UTC
    >DinoDNA "Dinosaur DNA" from Crichton JURASSIC PARK p. 103 nt 1-1200
    GCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGC
    GGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCG
    TGTT

older pastes →