Advertising
- Someone
- Friday, January 20th, 2012 at 9:47:47am MST
- !/opt/local/bin/perl
- use strict;
- use Bio::Graphics;
- use Bio::SeqFeature::Generic;
- use Bio::Graphics::Glyph::dna;
- use Bio::PrimarySeq;
- use Bio::Graphics::FeatureFile;
- my $dna = 'a'x300;
- my $feature_list = Bio::Graphics::FeatureFile->new;
- # find restriction sites
- my $i = 0;
- my $feature;
- my $abs_start = 0;
- $feature_list->add_type('test' => {glyph => 'generic', label => 'dna!', key => 'dna'});
- warn "For loop running?";
- for (my $a = 1; $a < length($dna); $a = $a + 100) {
- warn "A: " . $a . " " . length($dna);
- $feature = Bio::SeqFeature::Generic->new( -label => $a, -start =>$abs_start+$a, -end=> $abs_start+$a+40);
- $feature_list->add_feature($feature, 'test');
- }
- my($name,$score,$start,$end, $seq, $feature, $track);
- $seq = 'ACGGTCGATCGATCGATCGATCGTACGATCG'x5;
- my $panel = Bio::Graphics::Panel->new(
- -length => length($seq),
- -width => length($seq) * 7
- );
- $dna = Bio::PrimarySeq->new( -seq => $seq);
- $feature = Bio::Graphics::Feature->new( -start =>1, -end=> length($seq));
- $feature->attach_seq($dna);
advertising
Update the Post
Either update this post and resubmit it with changes, or make a new post.
You may also comment on this post.
Please note that information posted here will expire by default in one month. If you do not want it to expire, please set the expiry time above. If it is set to expire, web search engines will not be allowed to index it prior to it expiring. Items that are not marked to expire will be indexable by search engines. Be careful with your passwords. All illegal activities will be reported and any information will be handed over to the authorities, so be good.